Pre-designed Xenium Gene Expression Panels - Official 10x Genomics Support

The Xenium platform uses targeted panels to detect gene expression at subcellular resolution. The pre-designed panels were designed to cover the major cell types for specific tissues. They consist of genes selected from single cell atlas data, research area experts, and literature searches.

Consult the Xenium In Situ Gene Expression - Probe Hybridization, Ligation & Amplification User Guide (CG000582) to execute the workflow.

Additional resources

Download and explore 10x Genomics public datasets that use pre-designed and add-on custom panels here. Click here for Xenium panel part numbers (PN).

Table of contents

Pre-designed panel information

The table below provides the following information for available pre-designed Xenium gene expression panels:

Panel name and the number of targeted genes
Downloadable panel metadata with gene name, transcript ID, number of probe sets, number of codewords for each target, and cell type annotation in CSV format (see below for details).
Downloadable gene_panel JSON file for each panel.
Panel probe sequences in FASTA format and the genomic coordinates of the panel probe sequences in 12-column detailed BED format (see below for details).

Panel	Genes targeted	Panel metadata and JSON	Probe genomic target sequences and coordinates
Xenium Human Breast Gene Expression Panel	280	CSV, JSON	FASTA, BED
Xenium Mouse Brain Gene Expression Panel	247	CSV, JSON	FASTA, BED
Xenium Human Brain Gene Expression Panel	266	CSV, JSON	FASTA, BED
Xenium Human Lung Gene Expression Panel	289	CSV, JSON	FASTA, BED
Xenium Human Multi-Tissue and Cancer Panel	377	CSV^*, JSON	FASTA, BED
Xenium Mouse Tissue Atlassing Panel	379	CSV^*, JSON	FASTA, BED
Xenium Human Colon Gene Expression Panel	322	CSV, JSON	FASTA, BED
Xenium Human Skin Gene Expression Panel	260	CSV, JSON	FASTA, BED

*The Xenium Human Multi-Tissue and Cancer Panel and Xenium Mouse Tissue Atlassing Panel were developed to accommodate multiple human or mouse tissue types, respectively. Genes can be specifically expressed in different cell types, depending on the tissue context, and this is reflected in the annotation column of the CSV file. For example, the annotation "Breast - Breast glandular cells" indicates that this gene is expressed in that cell type, which is only present in breast tissue. Other cell types that are shared between multiple tissues were grouped under a "General" category. For example, the annotation "General - T cells" indicates that this gene is expressed in T cells, which are present in multiple tissues. You can use the annotations column to view the subset of genes targeted for specific tissue type(s) in your experiment, along with the "General" tissue category.

Panel negative controls

Each pre-designed panel contains 44 negative control codewords and 20 negative control probe sets (except the Xenium Mouse Brain Gene Expression Panel, which has 27).

For negative control probe sets, multiple probes are designed for each non-biological target sequence. It follows the same design process as for real target sequences, with a goal of reaching eight probe sets per target (for more detail, read the Getting Started with Xenium Panel Design page). An add-on custom panel will have the same number of negative control probe sets as the pre-designed panel it is based upon.

Decoding and negative controls are described on the Xenium Onboard Analysis algorithms page.

Custom panel information

Xenium pre-designed gene panels can accommodate up to 100 additional genes. For more information about add-on custom gene panels that are compatible with pre-designed panels or standalone custom gene panels, please read the Getting Started with Xenium Panel Design page.

Panel metadata

For each of the pre-designed panels, a metadata file is provided on this page (CSV format). This file contains additional panel information, which may be helpful for designing your experiment or custom add-on genes.

Column	Description
Gene	The gene identifier targeted by the probe.
Ensembl ID	The Ensembl gene identifier targeted by the probe.
Number of Probe sets	The number of probe sets targeting each isoform of the gene.
Codewords	The number of codewords used to decode each gene.
Annotation	The 10x Genomics cell type annotation given to each gene based on single cell atlas data, research area experts, and literature searches.

Probe genomic target sequences and coordinates

The FASTA file contains the panel probe sequences in FASTA format, as represented on the probes and reverse-complement to the targeted transcript in FASTA format. The sequence ID consists of the transcript ID, gene name, and a unique identifying string, e.g. ENSG00000134440|NARS|1f419e5.

The 12 column BED-formatted file contains the sequences and genomic coordinates of the probes. The fourth column corresponds to the sequence ID of the FASTA file. The underlying genomic references are GRCh38 for human and GRCm38 for mouse.

This file may be used to visualize the probe locations with genome browsers like IGV (Integrated Genomics Viewer) and the UCSC Genome Browser, or to intersect the probe locations with other genomic features of interest using tools like bedtools.

The BED file information is useful for determining whether probes span exon-exon junctions. For example, probe ENSG00000134440|NARS|1f419e5, has the following sequence:


>ENSG00000134440|NARS|1f419e5
TCCTTCTAACGCACCAATCTTCACACATTTTGGCTCTGGG

And its BED record shows the coordinates in the top row below:


chr18   57613656        57615656        ENSG00000134440|NARS|1f419e5    0       +       57613656        57615656        0              2       24,16   0,1984

Loading the BED file in IGV shows this probe spans two exons:

By zooming in, we see the probe sequence as represented in the FASTA file is the reverse-complement of the transcript sequence: