All datasets

Whole Mouse Pup (FFPE) with 5K Mouse Pan Tissue and Pathways Panel and Snap25a/Snap25b Add-on

In Situ Gene Expression dataset analyzed using Xenium Onboard Analysis 3.0.0

This is a large dataset, please read the Dataset overview for details on viewing the data.
Assess data quality
View summary metrics to assess data quality and more.
View summary
Visualize and explore data
Discover differentially expressed genes, visualize your favorite genes, and explore your data with our visualization software.

Learn about Xenium analysis

Overview

Xenium Prime 5K In Situ Gene Expression with Cell Segmentation data for a 1 day old mouse pup (FFPE) using the Xenium Prime 5K Mouse Pan Tissue and Pathways Panel, supplemented with add-on probes for the canonical Snap25a / Snap25b isoforms.

How to view data

Interactively explore data with Xenium Explorer by downloading the Xenium Output Bundle (or Xenium Explorer subset) file. The subset bundle contains the experiment.xenium, gene_panel.json, morphology_focus/ directory of multi-file OME-TIFF files, analysis_summary.html, cells.zarr.zip, cell_feature_matrix.zarr.zip, transcripts.zarr.zip, and analysis.zarr.zip files.

Note: For large Xenium datasets generated with XOA v3.0, such as this one, with > 200 million unique cell by transcript features (sparse matrix), Xenium Explorer does not support certain transcript and cell functions due to performance limits. See more information here.

See the Getting Started with Xenium Explorer page for more details. Follow these instructions to view the post-Xenium H&E image or image alignment file in Xenium Explorer.

Biomaterials

FFPE-preserved P1 mouse pup was purchased from AcePix Biosciences (Mouse C57BL/6, non-diseased, male, 9 weeks old).

Tissue preparation

Tissues were prepared following the Xenium In Situ for FFPE - Tissue Preparation Handbook (CG000578).

Probe hybridization, washing, ligation, amplification, and cell segmentation staining were performed following the Xenium Prime In Situ Gene Expression with optional Cell Segmentation Staining User Guide (CG000760).

Post-instrument processing followed the Demonstrated Protocol Xenium In Situ Gene Expression - Post-Xenium Analyzer H&E Staining (CG000613).

Gene panels

The Xenium Prime 5K Mouse Pan Tissue and Pathways Panel was designed to enable comprehensive cell type and cell state identification using publicly available single cell RNA sequencing data. The panels also cover canonical signaling pathways, as well as genes relevant to developmental biology and genes that are well known in biomedical literature.

In addition to the Xenium Prime 5K Mouse Pan Tissue and Pathways Panel, add-on probes were included for the canonical Snap25a (Snap25-201) / Snap25b (Snap25-202) isoforms. These isoforms are distinguished by a mutually exclusive fifth exon. To analyze these isoforms, a pair of probes were made for the exon-exon junction of each isoform (exon 4 to exon 5, and exon 5 to exon 6). The probe sequences of the concatenated 5' and 3' sides of the ligation junction (binder) are shown below for each isoform:

name,binder Snap25a_exon4_exon5,TTTGGTTATGTTGGATGAGCAAGGCGAACAACTGGAACGC Snap25a_exon5_exon6,GGCTTTGTGTGTGTCCCTGTAACAAGCTTAAATCCAGTGA Snap25b_exon4_exon5,GACTTTGGTTATGTTGGATGAGCAAGGCGAACAACTCGAT Snap25b_exon5_exon6,GCCTTTTCATATGTCCTTGTAACAAGCTTAAATCCAGTGA

Xenium Analyzer

The instrument run was performed following the Xenium Analyzer User Guide CG000584. The on-instrument analysis was run with Xenium Onboard Analysis v3.0.0.

MetricWhole mouse
Median transcripts per cell241
Cells detected1,298,870
Nuclear transcripts per 100 µm²540.6
High quality decoded transcripts detected523,674,865
Region area (µm²)224,148,512.8

This dataset is licensed under the Creative Commons Attribution 4.0 International (CC BY 4.0) license. 10x citation guidelines available here.