Support homeCytAssist Spatial Gene ExpressionDocumentationProbe Sets
Probe Set Reference CSV and Supporting Files

Probe Set Reference CSV and Supporting Files

The human and mouse probe sets are bundled with the Space Ranger software. The rat probe set must be downloaded separately, and will be bundled in a future Space Ranger release. Space Ranger and all individual probe sets can be downloaded here.

This page describes the following files:

FileDescription
Probe set reference CSV fileThis CSV file is a required input for Space Ranger to enable analysis of Visium FFPE data. It specifies the probe sequences used for probe alignment.
Probe off-target activity CSVA CSV file that lists probes with predicted off-target activity, excluded from analysis by default.
Probe set BED fileA BED12 file that contains the sequences and genomic coordinates of the probes. This file can be used to visualize the probe locations in a genome browser and intersect probe locations with other data sources.
Probe set metadata TSV fileA TSV file that lists probes with additional information about gene name and description.

Probe identifiers

Files containing information about individual probes have a column corresponding to the probe identifier (ID) that uniquely identifies each probe. Probe IDs take the following format:

gene_id|gene_name|probe_sequence_hash

For example, the probe for the gene TSPAN6 in the human whole transcriptome probe set, which has the Ensembl gene ID ENSG00000000003 in the GRCh38-2020-A reference, has the probe ID ENSG00000000003|TSPAN6|41ef80c.

A small number of probes whose ID includes the prefix DEPRECATED are always excluded from analysis. Not all reagent lots contain these deprecated probes.

File formats for probe set downloads

Probe set reference CSV file

This CSV file is a required input for Space Ranger to enable analysis of Visium FFPE data. It specifies the sequences used as a reference for probe alignment and the gene ID associated with each probe. This file is specified using the --probe-set argument to spaceranger count pipeline.

The following snippet is an example from a v1 probe set reference CSV file:

#probe_set_file_format=1.0 #panel_name=Visium Human Transcriptome Probe Set #panel_type=predesigned #reference_genome=GRCh38 #reference_version=2020-A gene_id,probe_seq,probe_id,included ENSG00000000003,ATCTT[...]TGCTT,ENSG00000000003|TSPAN6|41ef80c,TRUE ENSG00000000005,ATGAC[...]AGTAA,ENSG00000000005|TNMD|f11e5fc,TRUE ENSG00000000419,TTGTA[...]TTCCT,ENSG00000000419|DPM1|73ef065,TRUE ENSG00000000457,CTTGA[...]GGAAT,ENSG00000000457|SCYL3|e327340,TRUE [ ... ]

In the v2 probe set, many genes have 3-fold coverage i.e three probes per genes. The v2 probe set includes the column region, described below.

#probe_set_file_format=2.0 #panel_name=Visium Human Transcriptome Probe Set v2.0 #panel_type=predesigned #reference_genome=GRCh38 #reference_version=2020-A gene_id,probe_seq,probe_id,included,region ENSG00000000003,GGTGACACCACAACAATGCAACGTATTTTGGATCTTGTCTACTGCATGGC,ENSG00000000003|TSPAN6|8eab823,TRUE,spliced ENSG00000000003,TCTGCATCTCTCTGTGGAGTACAATCTTCAAGTTTACAGCAACTCTTAGG,ENSG00000000003|TSPAN6|9d7fe51,TRUE,unspliced ENSG00000000003,AAAGCTGTTCTTAATCTCATGTCTGAAAACAAATCCTACGATGGCAGCGA,ENSG00000000003|TSPAN6|d2b5833,TRUE,spliced ENSG00000000005,CGTGACGGGTCTTCTCTACTTTCACTTGAGGGACCACCCACTGTTCATTT,ENSG00000000005|TNMD|7790621,TRUE,unspliced ENSG00000000005,GCCTCGACGGCAGTAAATACAACAATAACCTCTCTCATCCAGCATGGGAT,ENSG00000000005|TNMD|923f04b,TRUE,unspliced [ ... ]

The columns of this file are:

Column NameDescription
gene_idThe Ensembl gene identifier targeted by the probe.
probe_seqThe nucleotide sequence of the probe, which is complementary to the transcript sequence. Probe sequences must be upper case.
probe_idThe probe identifier, whose format is described in Probe Identifier.
includedTRUE/FALSE flag specifying whether the probe is included in the filtered counts matrix output or excluded by the probe filter. See --no-probe-filter command line argument of spaceranger count. All probes of a gene must be marked TRUE in the included column for that gene to be included.
regionThe region of the gene targeted by the probe, which indicates whether a probe spans a splice junction by at least 10 bp (spliced) or not (unspliced). Present only in v2 probe set reference CSV.
gene_nameThe Ensembl gene symbol targeted by the probe. This column is only present in v1.1 and later

The file also contains a number of required metadata fields in the header in the format #key=value:

Metadata FieldDescription
panel_nameThe name of the probe set.
panel_typeAlways predesigned for predesigned probe sets.
reference_genomeThe reference genome build used for probe design.
reference_versionThe version of the Space Ranger reference transcriptome used for probe design.
probe_set_file_formatThe version of the probe set file format specification that this file conforms to.

Probe off-target activity CSV file

This CSV file lists probes with predicted off-target activity identified by alignment to the reference transcriptome.

The following snippet is an example of a probe off-target activity CSV file:

probe_id,off_target_genes ENSG00000004478|FKBP4|ed8be23,ENSG00000235256|FKBP4P7;ENSG00000251463|FKBP4P1;ENSG00000268234|FKBP4P6;ENSG00000269692|FKBP4P2;ENSG00000276457|FKBP4P8 ENSG00000005302|MSL3|46ea040,ENSG00000224287|MSL3P1;ENSG00000239254|AC009220.2 ENSG00000006015|REX1BD|8367ca6,ENSG00000130766|SESN2 ENSG00000011009|LYPLA2|f905390,ENSG00000228285|LYPLA2P1;ENSG00000236604|LYPLA2P3;ENSG00000269153|LYPLA2P2 ENSG00000029363|BCLAF1|4400f06,ENSG00000248966|BCLAF1P1 ENSG00000048545|GUCA1A|42f457b,ENSG00000287363|AL096814.2 ENSG00000051596|THOC3|2d7334d,ENSG00000170089|AC106795.1 ENSG00000055955|ITIH4|e3e9693,ENSG00000243696|AC006254.1 [ ... ]

The columns for this file are:

Column NameDescription
probe_idThe ID of the probe with predicted off-target activity.
off_target_genesA semicolon separated list of predicted off-target genes. For each off-target gene, the Ensembl gene ID and gene symbol are separated by a vertical bar.

Probe BED file

A BED12-formatted file that contains the sequences and genomic coordinates of the probes. This file may be used to visualize the probe locations with genome browsers like IGV (Integrated Genomics Viewer) and the UCSC Genome Browser or to intersect the probe locations with other genomic features of interest using tools like Bedtools.

The following snippet is from an example BED12 file:

chr1 69519 69569 ENSG00000186092|OR4F5|c4da86d 0 - 69519 69569 0 1 50 0 chr1 925956 926006 ENSG00000187634|SAMD11|87d23c4 0 - 925956 926006 0 1 50 0 chr1 958972 959022 ENSG00000188976|NOC2L|6b84612 0 + 958972 959022 0 1 50 0 chr1 963955 964005 ENSG00000187961|KLHL17|da46e9a 0 - 963955 964005 0 1 50 0 chr1 970295 970345 ENSG00000187583|PLEKHN1|848db4f 0 - 970295 970345 0 1 50 0 chr1 979664 979714 ENSG00000187642|PERM1|2aaf487 0 + 979664 979714 0 1 50 0 chr1 999353 999403 ENSG00000188290|HES4|cbe069d 0 + 999353 999403 0 1 50 0 chr1 1014261 1014311 ENSG00000187608|ISG15|8b560b9 0 - 1014261 1014311 0 1 50 0 chr1 1043324 1043374 ENSG00000188157|AGRN|f06ab24 0 - 1043324 1043374 0 1 50 0 chr1 1072173 1072223 ENSG00000237330|RNF223|522e0bc 0 + 1072173 1072223 0 1 50 0

The columns of BED12 files we provide are as follows (adapted from UCSC Genome Browser documentation):

Column NameDescription
chromosomeChromosome of the target gene.
chromStart0-based start coordinate of the targeted sequence on the chromosome.
chromEnd0-based non-inclusive end coordinate on the chromosome.
nameprobe ID as described above.
scoreSet to 0 for all entries.
strand+ or - to indicate the strand of the targeted gene.
thickStartThe starting position at which the feature is drawn as a thick line in browsers (matches display of the corresponding transcript region).
thickEndThe ending position at which the feature is drawn as a thick line in browsers (matches display of the corresponding transcript region).
itemRgbSet to 0 for all entries.
blockCountThe number of blocks (continuous intervals).
blockSizesComma-separated list of the block sizes, contains blockCount entries.
blockStartsComma-separated list of block starts relative to chromStart column, contains blockCount entries.

The BED12 format was chosen because it allows probes that span splice junctions to be conveniently represented on a single line and allows genome browsers to visualize links between regions of probes that are discontinuous in genomic space. Browsers such as UCSC Genome Browser or IGV will render BED12 files appropriately, similar to how transcripts in the genome are displayed.

This format is also well-supported by command-line tools. For example, bedtools provides a -split command-line flag for some subcommands to allow the individual blocks within each line of a BED12 file to be treated independently as needed. This can be useful for calculating intersections, for example, where you may be interested in intersections with the regions covered by the probes themselves rather than intersections with the entire genomic interval the probe coordinates span including intronic regions. bedtools also provides the subcommand bed12tobed6 for conversion of BED12 files to BED6 format -- in the resulting file each probe would appear on multiple lines when spanning one or more splice junctions.

Probe set metadata TSV file

This TSV file lists additional metadata information of gene name and description for the genes targeted by probes. The file contains all the columns from Probe set reference CSV file along with the additional two columns. This file does not list the DEPRECATED probes.

The following snippet is an example from the v1 human probe metadata TSV file:

$ column -t -s $'\t' Visium_Human_Transcriptome_Probe_Set_v1.0_GRCh38-2020-A.probe_metadata.tsv | less --chop-long-lines probe_id gene_id gene_name gene_description probe_seq included ENSG00000000003|TSPAN6|41ef80c ENSG00000000003 TSPAN6 tetraspanin 6 ATCTTGTCTACTGCATGGCTTCTATAATCTCCTGTAGAGTTATACTGCTT TRUE ENSG00000000005|TNMD|f11e5fc ENSG00000000005 TNMD tenomodulin ATGACTCGTCCTCCTTGGTAGCAGTATGGATATGGGTAGTAGCCTAGTAA TRUE ENSG00000000419|DPM1|73ef065 ENSG00000000419 DPM1 dolichyl-phosphate mannosyltransferase subunit 1, catalytic TTGTAGCGAGTTCCAGAGACAATATCAAAATTACCCTCCTTTTGCTTCCT TRUE ENSG00000000457|SCYL3|e327340 ENSG00000000457 SCYL3 SCY1 like pseudokinase 3 CTTGATTTCCAAGGCATAGACTCTTCAGTGAGTGAAAGCAAAGCAGGAAT TRUE

The following snippet is an example from the v2.1 human probe metadata TSV file:

$ column -t -s $'\t' Visium_Human_Transcriptome_Probe_Set_v2.1.0_GRCh38-2024-A.probe_metadata.tsv probe_id gene_id gene_name gene_description probe_seq included transcript_id_set region ENSG00000000003|TSPAN6|8eab823 ENSG00000000003 TSPAN6 tetraspanin 6 GGTGACACCACAACAATGCAACGTATTTTGGATCTTGTCTACTGCATGGC TRUE ENST00000373020;ENST00000494424;ENST00000496771;ENST00000612152 spliced ENSG00000000003|TSPAN6|9d7fe51 ENSG00000000003 TSPAN6 tetraspanin 6 TCTGCATCTCTCTGTGGAGTACAATCTTCAAGTTTACAGCAACTCTTAGG TRUE ENST00000373020;ENST00000496771;ENST00000612152 unspliced ENSG00000000003|TSPAN6|d2b5833 ENSG00000000003 TSPAN6 tetraspanin 6 AAAGCTGTTCTTAATCTCATGTCTGAAAACAAATCCTACGATGGCAGCGA TRUE ENST00000373020;ENST00000494424;ENST00000496771;ENST00000612152 spliced ENSG00000000005|TNMD|7790621 ENSG00000000005 TNMD tenomodulin CGTGACGGGTCTTCTCTACTTTCACTTGAGGGACCACCCACTGTTCATTT TRUE ENST00000373031 unspliced ENSG00000000005|TNMD|923f04b ENSG00000000005 TNMD tenomodulin GCCTCGACGGCAGTAAATACAACAATAACCTCTCTCATCCAGCATGGGAT TRUE ENST00000373031 unspliced

The columns of this file in order are:

Column NameDescription
probe_idProbe ID, same as in Probe set reference CSV file. The format is described in Probe identifiers.
gene_idGene ID from the probe ID, same as in Probe set reference CSV file.
gene_nameGene name from the probe ID (e.g. ACTA1), same as in probe set file.
gene_descriptionLong-form gene description from Ensembl (e.g. actin alpha 1, skeletal muscle).
probe_seqTemplated portion of probe pair sequence, same as in Probe set reference CSV file.
includedTRUE/FALSE flag specifying whether the probe is included in the filtered counts matrix output or excluded by the probe filter and is same as that in Probe set reference CSV file. See --no-probe-filter command line argument of spaceranger count. All probes of a gene must be marked TRUE in the included column for that gene to be included.
transcript_id_setSemicolon-separated list of the set of transcripts that this particular probe was designed to cover. There may be transcripts outside of GENCODE basic that are covered but not listed here. Ensembl transcript IDs are used.
regionCorresponds to the region column of the probe set reference CSV (only in v2 reference CSV). The gene boundary targeted by the probe. Accepted values are spliced or unspliced.
Document Type
Overview

Last Modified
July 20, 2026