Support homeSpatial Gene Expression for FFPEDocumentationProbe Sets
Probe Set Reference CSV and Supporting Files

Probe Set Reference CSV and Supporting Files

Visium probe sets are bundled with the Space Ranger software. Both Space Ranger and individual probe sets can be downloaded here.

This page describes the following files:

FileDescription
Probe set reference CSV fileThis CSV file is a required input for Space Ranger to enable analysis of Visium FFPE data. It specifies the probe sequences used for probe alignment.
Probe off-target activity CSVA CSV file that lists probes with predicted off-target activity, excluded from analysis by default.
Probe set BED fileA BED12 file that contains the sequences and genomic coordinates of the probes. This file can be used to visualize the probe locations in a genome browser and intersect probe locations with other data sources.
Probe set metadata TSV fileA TSV file that lists probes with additional information about gene name and description.

Probe identifiers

Files containing information about individual probes have a column corresponding to the probe identifier (ID) that uniquely identifies each probe. Probe IDs take the following format:

gene_id|gene_name|probe_sequence_hash

For example, the probe for the gene TSPAN6 in the human whole transcriptome probe set, which has the Ensembl gene ID ENSG00000000003 in the GRCh38-2020-A reference, has the probe ID ENSG00000000003|TSPAN6|41ef80c.

A small number of probes whose ID includes the prefix DEPRECATED are always excluded from analysis. Not all reagent lots contain these deprecated probes.

File formats for probe set downloads

Probe set reference CSV file

This CSV file is a required input for Space Ranger to enable analysis of Visium FFPE data. It specifies the sequences used as a reference for probe alignment and the gene ID associated with each probe. This file is specified using the --probe-set argument to spaceranger count pipeline.

The following snippet is an example from a v1 probe set reference CSV file:

#probe_set_file_format=1.0 #panel_name=Visium Human Transcriptome Probe Set #panel_type=predesigned #reference_genome=GRCh38 #reference_version=2020-A gene_id,probe_seq,probe_id,included ENSG00000000003,ATCTT[...]TGCTT,ENSG00000000003|TSPAN6|41ef80c,TRUE ENSG00000000005,ATGAC[...]AGTAA,ENSG00000000005|TNMD|f11e5fc,TRUE ENSG00000000419,TTGTA[...]TTCCT,ENSG00000000419|DPM1|73ef065,TRUE ENSG00000000457,CTTGA[...]GGAAT,ENSG00000000457|SCYL3|e327340,TRUE [ ... ]

In the v2 probe set, many genes have 3-fold coverage i.e three probes per genes. The v2 probe set includes the column region, described below.

#probe_set_file_format=2.0 #panel_name=Visium Human Transcriptome Probe Set v2.0 #panel_type=predesigned #reference_genome=GRCh38 #reference_version=2020-A gene_id,probe_seq,probe_id,included,region ENSG00000000003,GGTGACACCACAACAATGCAACGTATTTTGGATCTTGTCTACTGCATGGC,ENSG00000000003|TSPAN6|8eab823,TRUE,spliced ENSG00000000003,TCTGCATCTCTCTGTGGAGTACAATCTTCAAGTTTACAGCAACTCTTAGG,ENSG00000000003|TSPAN6|9d7fe51,TRUE,unspliced ENSG00000000003,AAAGCTGTTCTTAATCTCATGTCTGAAAACAAATCCTACGATGGCAGCGA,ENSG00000000003|TSPAN6|d2b5833,TRUE,spliced ENSG00000000005,CGTGACGGGTCTTCTCTACTTTCACTTGAGGGACCACCCACTGTTCATTT,ENSG00000000005|TNMD|7790621,TRUE,unspliced ENSG00000000005,GCCTCGACGGCAGTAAATACAACAATAACCTCTCTCATCCAGCATGGGAT,ENSG00000000005|TNMD|923f04b,TRUE,unspliced [ ... ]

The columns of this file are:

Column NameDescription
gene_idThe Ensembl gene identifier targeted by the probe.
probe_seqThe nucleotide sequence of the probe, which is complementary to the transcript sequence. Probe sequences must be upper case.
probe_idThe probe identifier, whose format is described in Probe Identifier.
includedTRUE/FALSE flag specifying whether the probe is included in the filtered counts matrix output or excluded by the probe filter. See --no-probe-filter command line argument of spaceranger count. All probes of a gene must be marked TRUE in the included column for that gene to be included.
regionThe region of the gene targeted by the probe, which indicates whether a probe spans a splice junction by at least 10 bp (spliced) or not (unspliced). Present only in v2 probe set reference CSV.

The file also contains a number of required metadata fields in the header in the format #key=value:

Metadata FieldDescription
panel_nameThe name of the probe set.
panel_typeAlways predesigned for predesigned probe sets.
reference_genomeThe reference genome build used for probe design.
reference_versionThe version of the Space Ranger reference transcriptome used for probe design.
probe_set_file_formatThe version of the probe set file format specification that this file conforms to.

Probe off-target activity CSV file

This CSV file lists probes with predicted off-target activity identified by alignment to the reference transcriptome.

The following snippet is an example of a probe off-target activity CSV file:

$ column -s, -t < Visium_Human_Transcriptome_Probe_Set_v2.0_GRCh38-2020-A.offtarget.csv | less -S probe_id off_target_genes ENSG00000004478|FKBP4|ed8be23 ENSG00000235256|FKBP4P7;ENSG00000251463|FKBP4P1;ENSG00000268234|FKBP4P6;ENSG00000269692|FKBP4P2;ENSG00000276457|FKBP4P8 ENSG00000005302|MSL3|46ea040 ENSG00000224287|MSL3P1;ENSG00000239254|AC009220.2 ENSG00000006015|REX1BD|8367ca6 ENSG00000130766|SESN2 ENSG00000011009|LYPLA2|f905390 ENSG00000228285|LYPLA2P1;ENSG00000236604|LYPLA2P3;ENSG00000269153|LYPLA2P2 ENSG00000029363|BCLAF1|4400f06 ENSG00000248966|BCLAF1P1 ENSG00000048545|GUCA1A|42f457b ENSG00000287363|AL096814.2 ENSG00000051596|THOC3|2d7334d ENSG00000170089|AC106795.1 ENSG00000055955|ITIH4|e3e9693 ENSG00000243696|AC006254.1 ENSG00000058673|ZC3H11A|0f1fc9b ENSG00000257315|ZBED6 ENSG00000065371|ROPN1|f33b60a ENSG00000114547|ROPN1B ENSG00000069329|VPS35|bb6ea42 ENSG00000260809|VPS35P1 [ ... ]

The columns for this file are:

Column NameDescription
probe_idThe ID of the probe with predicted off-target activity.
off_target_genesA semicolon separated list of predicted off-target genes. For each off-target gene, the Ensembl gene ID and gene symbol are separated by a vertical bar.

Probe BED file

A BED12-formatted file that contains the sequences and genomic coordinates of the probes. This file may be used to visualize the probe locations with genome browsers like IGV (Integrated Genomics Viewer) and the UCSC Genome Browser or to intersect the probe locations with other genomic features of interest using tools like Bedtools.

The following snippet is from an example BED12 file:

chr1 69519 69569 ENSG00000186092|OR4F5|c4da86d 0 - 69519 69569 0 1 50 0 chr1 925956 926006 ENSG00000187634|SAMD11|87d23c4 0 - 925956 926006 0 1 50 0 chr1 958972 959022 ENSG00000188976|NOC2L|6b84612 0 + 958972 959022 0 1 50 0 chr1 963955 964005 ENSG00000187961|KLHL17|da46e9a 0 - 963955 964005 0 1 50 0 chr1 970295 970345 ENSG00000187583|PLEKHN1|848db4f 0 - 970295 970345 0 1 50 0 chr1 979664 979714 ENSG00000187642|PERM1|2aaf487 0 + 979664 979714 0 1 50 0 chr1 999353 999403 ENSG00000188290|HES4|cbe069d 0 + 999353 999403 0 1 50 0 chr1 1014261 1014311 ENSG00000187608|ISG15|8b560b9 0 - 1014261 1014311 0 1 50 0 chr1 1043324 1043374 ENSG00000188157|AGRN|f06ab24 0 - 1043324 1043374 0 1 50 0 chr1 1072173 1072223 ENSG00000237330|RNF223|522e0bc 0 + 1072173 1072223 0 1 50 0

The columns of BED12 files we provide are as follows (adapted from UCSC Genome Browser documentation):

Column NameDescription
chromosomeChromosome of the target gene.
chromStart0-based start coordinate of the targeted sequence on the chromosome.
chromEnd0-based non-inclusive end coordinate on the chromosome.
nameprobe ID as described above.
scoreSet to 0 for all entries.
strand+ or - to indicate the strand of the targeted gene.
thickStartThe starting position at which the feature is drawn as a thick line in browsers (matches display of the corresponding transcript region).
thickEndThe ending position at which the feature is drawn as a thick line in browsers (matches display of the corresponding transcript region).
itemRgbSet to 0 for all entries.
blockCountThe number of blocks (continuous intervals).
blockSizesComma-separated list of the block sizes, contains blockCount entries.
blockStartsComma-separated list of block starts relative to chromStart column, contains blockCount entries.

The BED12 format was chosen because it allows probes that span splice junctions to be conveniently represented on a single line and allows genome browsers to visualize links between regions of probes that are discontinuous in genomic space. Browsers such as UCSC Genome Browser or IGV will render BED12 files appropriately, similar to how transcripts in the genome are displayed.

This format is also well-supported by command-line tools. For example, bedtools provides a -split command-line flag for some subcommands to allow the individual blocks within each line of a BED12 file to be treated independently as needed. This can be useful for calculating intersections, for example, where you may be interested in intersections with the regions covered by the probes themselves rather than intersections with the entire genomic interval the probe coordinates span including intronic regions. bedtools also provides the subcommand bed12tobed6 for conversion of BED12 files to BED6 format -- in the resulting file each probe would appear on multiple lines when spanning one or more splice junctions.

Probe set metadata TSV file

This TSV file lists additional metadata information of gene name and description for the genes targeted by probes. The file contains all the columns from Probe set reference CSV file along with the additional two columns. This file does not list the DEPRECATED probes.

The following is the code and snippet from the v1 human probe metadata TSV file:

$ column -t -s $'\t' Visium_Human_Transcriptome_Probe_Set_v1.0_GRCh38-2020-A.probe_metadata.tsv | less --chop-long-lines probe_id gene_id gene_name gene_description probe_seq included ENSG00000000003|TSPAN6|41ef80c ENSG00000000003 TSPAN6 tetraspanin 6 ATCTTGTCTACTGCATGGCTTCTATAATCTCCTGTAGAGTTATACTGCTT TRUE ENSG00000000005|TNMD|f11e5fc ENSG00000000005 TNMD tenomodulin ATGACTCGTCCTCCTTGGTAGCAGTATGGATATGGGTAGTAGCCTAGTAA TRUE ENSG00000000419|DPM1|73ef065 ENSG00000000419 DPM1 dolichyl-phosphate mannosyltransferase subunit 1, catalytic TTGTAGCGAGTTCCAGAGACAATATCAAAATTACCCTCCTTTTGCTTCCT TRUE ENSG00000000457|SCYL3|e327340 ENSG00000000457 SCYL3 SCY1 like pseudokinase 3 CTTGATTTCCAAGGCATAGACTCTTCAGTGAGTGAAAGCAAAGCAGGAAT TRUE

The following is the code and snippet from the v2 human probe metadata TSV file which includes some additional columns:

$ column -t -s $'\t' Visium_Human_Transcriptome_Probe_Set_v2.0_GRCh38-2020-A.probe_metadata.tsv | less --chop-long-lines probe_id gene_id gene_name gene_description probe_seq included gene_total_coverage_rounds coverage_round transcript_id_set ENSG00000000003|TSPAN6|8eab823 ENSG00000000003 TSPAN6 tetraspanin 6 GGTGACACCACAACAATGCAACGTATTTTGGATCTTGTCTACTGCATGGC TRUE 3 1 ENST00000373020;ENST00000612152;ENST00000614008 ENSG00000000003|TSPAN6|9d7fe51 ENSG00000000003 TSPAN6 tetraspanin 6 TCTGCATCTCTCTGTGGAGTACAATCTTCAAGTTTACAGCAACTCTTAGG TRUE 3 2 ENST00000373020;ENST00000612152;ENST00000614008 ENSG00000000003|TSPAN6|d2b5833 ENSG00000000003 TSPAN6 tetraspanin 6 AAAGCTGTTCTTAATCTCATGTCTGAAAACAAATCCTACGATGGCAGCGA TRUE 3 3 ENST00000373020;ENST00000612152;ENST00000614008 ENSG00000000005|TNMD|7790621 ENSG00000000005 TNMD tenomodulin CGTGACGGGTCTTCTCTACTTTCACTTGAGGGACCACCCACTGTTCATTT TRUE 3 1 ENST00000373031 ENSG00000000005|TNMD|ab5ef5a ENSG00000000005 TNMD tenomodulin AAGGCATGATGACACGACAGATGACTCGTCCTCCTTGGTAGCAGTATGGA TRUE 3 2 ENST00000373031

The columns of this file in order are:

Column NameDescription
probe_idProbe identifier, as included in Probe set reference CSV file. The format is described in Probe identifiers.
gene_idThe Ensembl gene identifier targeted by the probe, same as in Probe set reference CSV file.
gene_nameThe official HGNC gene symbol targeted by the probe.
gene_descriptionThe official HGNC gene full name targeted by the probe.
probe_seqThe nucleotide sequence of the probe, which is complementary to the transcript sequence, same as in Probe set reference CSV file.
includedTRUE/FALSE flag specifying whether the probe is included in the filtered counts matrix output or excluded by the probe filter and is same as that in Probe set reference CSV file. See --no-probe-filter command line argument of spaceranger count. All probes of a gene must be marked TRUE in the included column for that gene to be included.
regionPresent only in v2 probe set reference CSV. Region column from the reference probe_set.csv and values can be either spliced or unspliced.
gene_total_coverage_roundsPresent only in v2 probe set reference CSV. The total number of coverage rounds that are present for this gene (fold-coverage of all transcripts for that gene within the panel).
coverage_roundPresent only in v2 probe set reference CSV. 1, 2, or 3 – the round of coverage to which the probe belongs. Counts from probes belonging to the same coverage round must be added together to get the full gene-level count for that round of coverage. gene_total_coverage_rounds is the max of this of this column within the gene this probe is designed.
transcript_id_setPresent only in v2 probe set reference CSV. Semicolon-separated list of the set of transcripts that this particular probe was designed to cover. There may be transcripts outside of GENCODE basic that are covered but not listed here. Ensembl transcript IDs are used.
Document Type
Overview

Last Modified
June 10, 2024